Review



sys br primix ex taq 2 solution  (PRIMIX Corporation)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    PRIMIX Corporation sys br primix ex taq 2 solution
    Sys Br Primix Ex Taq 2 Solution, supplied by PRIMIX Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sys+br+primix+ex+taq+2+solution/sybr++primix+ex+taqtm/pmc05080684-72-10-12
    Average 90 stars, based on 1 article reviews
    sys br primix ex taq 2 solution - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Integrins β1 and β3 are biomarkers of uterine condition for embryo transfer
    Article Snippet: The 20 μL reaction mixture consisted of 10 μL of SYS BR Primix Ex Taq 2 solution, 0.5 μL of each primer ( integrin β1 , forward primer: ATGTGTCAGACCTGCCTTGG, reverse primer: GGGACACAGGATCAGGTTGG; integrin β3 , forward primer: GGCAAGTGTGAATGTGGCAG, reverse primer: GACTCAATCTCGTCACGGCA; GAPDH forward primer: 5′-TATGATGATATCAAGAGGGTAGT, reverse primer, 5′-TGTATCCAAACTCATTGTCATAC-3′), 1 μL of the cDNA template, and 8 μL of RNase-free H 2 O.



    Similar Products

    sys br primix ex taq 2 solution  (PRIMIX Corporation)
    90
    PRIMIX Corporation sys br primix ex taq 2 solution
    Sys Br Primix Ex Taq 2 Solution, supplied by PRIMIX Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sys+br+primix+ex+taq+2+solution/sybr++primix+ex+taqtm/pmc05080684-72-10-12
    Average 90 stars, based on 1 article reviews
    sys br primix ex taq 2 solution - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results